Signal Transduction in Astrocytes during Chronic or Acute Treatment with Drugs (SSRIs, Antibipolar Drugs, GABA-ergic Drugs, and Benzodiazepines) Ameliorating Mood Disorders
Figure 3
mRNA of mGluR5 is not upregulated in either astrocytes or neurons freshly isolated from animals treated with fluoxetine (10 mg fluoxetine hydrochloride/kg, i.p.) for 14 days. In both cases, astrocytes had been stained with GFP and neurons with YPHF in transgenic animals and they were separated after cell dissociation by means of the different fluorescent signals. (a) Blot showing mGluR5 RNA measured by reverse transcription polymerase chain reaction (RT-PCR) in all experiments together with that of TATA-binding protein (TBP) used as housekeeping gene (as a further check for application of similar amounts of total mRNA). mGluR5 PCR product is 513 bp. Primer sequence for mGlur5 is FWD: 5′GTCTCCTGATGTCAAGTGGTT3′; REV: 5′GGACCACACTTCATCATCATC3′. (b) mGlu5R/TBP expression ratio is virtually unaffected by fluoxetine treatment regardless of whether normal mice (left part of (b)) or mice that showed some signs of depression after exposure to chronic mild stress (CMS) (right part of (b)) were studied. Unpublished experiments by B. Li and L. Peng, using methodology similar to that used by Li et al. [22].
